UP Board Class 12 Biology

Class 12 Biology Chapter 6 “Molecular Basis of Inheritance”

UP Board Master for Class 12 Biology Chapter 6 “Molecular Basis of Inheritance” (“वंशागति का आणविक आधार”) are part of UP Board Master for Class 12 Biology. Here we have given UP Board Master for Class 12 Biology Chapter 6 Molecular Basis of Inheritance (वंशागति का आणविक आधार).

Board UP Board
Textbook NCERT
Class Class 12
Subject Biology
Chapter Chapter 6
Chapter Name “Molecular Basis of Inheritance”
Number of Questions Solved 37
Category UP Board Master

UP Board Master for Class 12 Biology Chapter 6 “Molecular Basis of Inheritance” (“वंशागति का आणविक आधार”)

कक्षा 12 जीव विज्ञान अध्याय 6 के लिए यूपी बोर्ड मास्टर “विरासत का आणविक फाउंडेशन” (“विरासत का आणविक फाउंडेशन”)

Q & A द्वारा निरीक्षण किया गया

प्रश्न 1.
नाइट्रोजनी क्षार और न्यूक्लियोटाइड के रूप में अगले को वर्गीकृत करें – एडेनिन, साइटिडीन, थाइमिन, गुआनोसिन, यूरैसिल और साइटोसिन।
उत्तर:
नाइट्रोजनयुक्त क्षार  – एडेनिन, थाइमिन, यूरैसिल, साइटोसिन।
न्यूक्लियोटाइड  – साइटिडीन, गुआनोसिन।

प्रश्न 2.
यदि डबल-असहाय डीएनए में 20 पीसी साइटोसिन है, तो डीएनए के भीतर खोजे गए एडेनिन के हिस्से की गणना करें।
उत्तर
4 रेखांकन की नींव के साथ, डबल-फंसे हुए डीएनए में → A + G = T + C = 1. है, इस कारण, एडेनिन = थाइमिन,
ग्वानिन = साइटोसिन,
इस कारण से कि साइटोसिन की मात्रा 20% है, तब ग्वानिन 20% भी हो सकती है।
गुआनिन + साइटोसिन = 20 + 20 = 40%
ए + जी = 100 – 40%
ए + जी = 60%
चूंकि ए = जी है; इसलिए, एडेनिन की मात्रा = 60/2 = 30% होगी।

प्रश्न 3.
यदि डीएनए के डीएनए स्ट्रैंड के अनुक्रम को
5 – If – ATGCATGCATGCATGCATGCATGCATGCATGC – 3 sequence के रूप में लिखा जाता है ,
तो पूरक स्ट्रैंड के अनुक्रम को 5 → तीन पथ में लिखें।
उत्तर
डी ज़ीरो एन ज़ीरो ए 0  डीविकुंडली निर्माण  यह है कि इसमें दो  पोलीन्यूक्लियोटाइड्स अनुक्रम  हैं ( पॉली न्यूक्लियोटाइड श्रृंखला) से बना है। प्रत्येक अनुक्रम में समानांतर ध्रुवीयता होती है। जिसका अर्थ है कि यदि 1 अनुक्रम की ध्रुवता 5 से तीन polar है, तो विपरीत की ध्रुवता तीन से पांच polar तक होगी।

2 जंजीरों के नाइट्रोजनस आधार हाइड्रोजन  बांड द्वारा परस्पर जुड़े  होते हैं। एडीनाइन  है  थाइमिन से जुड़े  (एक = टी) दो हाइड्रोजन बांड द्वारा और  करने के लिए साइटोसिन  गुआनिन  तीन हाइड्रोजन बांड द्वारा (सी ≡ जी)। परिणाम में  प्यूरीन  अन्य तरीके से (प्यूरीन)  Pirimidin  (pyrimidine) है। यह डीएनए नाभिक के 2 पॉली न्यूक्लियोटाइड के बीच समान दूरी बनाए रखता है। इसलिए  , अनुक्रम  की  nitrogenized क्षार  में  संपूरक स्ट्रैंड  की (चेन)  डीएनए  होगा – 5 ‘- ATGCATGCATGCATGCATGCATGCATGC -3’ 3 ‘- TACGTACGTACGTACGTACGTACGTACG-5’।

प्रश्न 4.
यदि प्रतिलेखन इकाई के भीतर कोडिंग स्ट्रिंग का क्रम निम्नानुसार लिखा गया है –
5 sequence – ATGCATGCATGCATGCATGCATGCATGCATGC – 3 write
तो मैसेंजर-आरएनए का अनुक्रम लिखें।
उत्तर:
आरएनए का निर्माण डीएनए आर जीरो एन जीरो ए 0 से होता है। कभी-कभी  अक्रुज़ुकी निर्माण  गिरता है (एकल स्ट्रैंड निर्माण)। यह  Thaimin  जगह Naitrojnikrit बेस  uracil  (uracil) की खोज की है। डी शून्य एन शून्य एक शून्य Akrjjuk आनुवंशिक जानकारी की (प्रतिलेखन इकाई)  दूत आर शून्य n शून्य एक 0  (MRkNA) को कॉपी करने की विधि  को कॉपी  (प्रतिलिपि) के रूप में जाना जाता है।
यदि कोडिंग स्ट्रैंड का क्रम निम्नानुसार है –
5 cod – ATGCATGCATGCATGCATGCATGCATGC – 3 ‘।
तो मैसेंजर-आरएनए (mR.NA) का क्रम इस प्रकार होगा –
5 enger – AUGCAUGCAUGCAUGCAUGCACACAC – 3 enger

प्रश्न 5.
डीएनए की कौन सी विशेषता ढिकुंडली ने वाटसन और क्रिक को डीएनए प्रतिकृति के अर्ध-रूढ़िवादी प्रकार की कल्पना करने में मदद की? इसे स्पष्ट करें।
उत्तर:
वाटसन और क्रिक ने डीएनए का एक द्विभाजित पुतला दिया। इस पुतले की सिद्धांत विशेषता पोलीन्यूक्लियोटाइड श्रृंखलाओं के बीच युग्मन थी। पॉली न्यूक्लियोटाइड श्रृंखलाओं में क्षार युग्मन एक विशेषता थी जिसने वाटसन और क्रिक ने एक अर्ध-रूढ़िवादी प्रकार के डीएनए प्रतिकृति की कल्पना की। क्षार-युग्मन की इस संपत्ति के आधार पर, श्रृंखलाएं एक दूसरे के पूरक हैं, अर्थात, जब एक एकल डीएनए स्ट्रैंड में क्षार अनुक्रम का पता लगाया जाता है, तो एक दूसरे स्ट्रैंड के क्षार युग्मन को मान्यता दी जाएगी।

साथ ही, डीएनए के प्रत्येक स्ट्रैंड नवीनतम डीएनए स्ट्रैंड के संश्लेषण के लिए एक फफूंदी के रूप में कार्य करते हैं। इस फफूंदी से आकार का डबल-स्ट्रैंडेड डीएनए अपनी माँ या पिता डीएनए के बराबर है। डीएनए प्रतिकृति की अर्ध-रूढ़िवादी पद्धति के भीतर, डीएनए के प्रत्येक किस्में अलग-अलग होती हैं और नवीनतम किस्में के संश्लेषण के लिए फफूंदी के समान प्रदर्शन करती हैं। डीएनए प्रतिकृति में एक माँ या पिता स्ट्रैंड और एक नया स्ट्रैंड होता है।

प्रश्न 6.
मुख्य रूप से टेम्पलेट (डीएनए या आरएनए) की रासायनिक प्रकृति और उसमें से संश्लेषित न्यूक्लिक एसिड के चरित्र (डीएनए या आरएनए) के आधार पर कई प्रकार के न्यूक्लिक एसिड पोलीमरेज़ को रिकॉर्ड करें।
उत्तर
न्यूक्लिक एसिड पोलीमरेज़ निम्नानुसार हैं –
1.  डी जीरो एन ज़ीरो ए 0 पोलीमरेज़  (डीएनए पोलीमरेज़) एंजाइम प्रतिकृति (प्रतिकृति) के लिए आवश्यक है। यह डी-ऑक्सीन्यूक्लियोटाइड के पोलीमराइजेशन को प्रेरित करने के लिए डीएनए टेम्पलेट का उपयोग करता है। डीएनए अणुओं की 2 श्रृंखलाएं सामूहिक रूप से अलग नहीं होती हैं। प्रतिकृति के लिए छोटे तत्वों में डीएनए बिकुस्फियर खुलता है।  इस डीएनए डीएनए एंजाइम के कारण उस तरह के  अनुक्रम डीएनए पोलीमरेज़ द्वारा जोड़े जाते हैं जो स्वयं द्वारा प्रतिकृति पाठ्यक्रम को भड़काने नहीं कर सकते हैं। सुनिश्चित वेबसाइटों पर  कंडक्टर (वेक्टर) द्वारा समर्थित है।

2.  R Zero n Zero A0 पोलीमरेज़  (RNA पोलीमरेज़) – D Zero N Zero A जितना Zero R Zero n Zero A0 पोलीमरेज़ (DNA निर्भर करता है RNA पोलीमरेज़)। यह डीएनए आर शून्य n शून्य हर तरह की A0  लिप्यंतरित  बंद (ट्रांसक्रिप्शन) सेट। आरएनए पोलीमरेज़ जल्दी शुरू होता है या एक आरंभिक अंक या एक समाप्ति मुद्दे से जोड़कर प्रतिलेखन को पूरा करता है। डीएनए के आधार पर आरएनए पोलीमरेज़ के साथ, आरएनए पोलीमरेज़ के अगले तीन रूपों को नाभिक के भीतर पाया जा सकता है –

  1. आरएनए पोलीमरेज़ I  – यह राइबोसोमल आरएनए (rR.NA) को स्थानांतरित करता है।
  2. आरएनए पॉलीमरेज़  III  – यह स्विच आरएनए के ट्रांसक्रिप्शन और छोटे केंद्रीकृत आरएनए के लिए जवाबदेह है।
  3. आरएनए पोलीमरेज़  II  – यह पूर्ववर्ती आरएनए (mR.NA) के पूर्ववर्ती परमाणु आरएनए-hnR.NA पूर्वकाल को प्रसारित करता है।

प्रश्न 7.
उनके प्रयोग से पता चलता है कि डीएनए एक आनुवंशिक सामग्री है, हरने और चेस ने डीएनए और प्रोटीन के बीच अंतर कैसे किया?
उत्तर:
चेस ने  एक आनुवंशिक सामग्री के रूप में डीएनए को दिखाने के लिए P 32  और P  32 समस्थानिक वाले एक माध्यम में ई। कोलाई सूक्ष्म जीव की खेती की है  । थोड़ी देर के लिए उठने के बाद, सूक्ष्म जीव बैक्टीरियोफेज द्वारा दूषित हो गया था। प्रोटीन आवरण की खोज की गई थी कि एक संक्रमण एस 35 के बाद जीवाणु   जबकि यह रेडियोधर्मी था जिसमें डीएनए में सल्फर नहीं होता है। डिस्टिंक्शन बैक्टीरियोफेज के डीएनए पी  32  में डीएनए के परिणामस्वरूप रेडियोधर्मी ऐसोटोप्स की उपस्थिति की पुष्टि की गई

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड सॉल्यूशंस इनहेरिटेंस Q.7 के आणविक आधार

फॉस्फोरस को शामिल करता है। P  32  प्रोटीन लिफाफे के भीतर अनुपस्थित था। P  32  रेडियोएक्टिव सूक्ष्म जीव युक्त एक बैक्टीरियोफेज रेडियोधर्मी घटकों के साथ दूषित। एक संक्रमण के बाद यह देखा गया कि प्रत्येक एक सूक्ष्म जीव रेडियोधर्मी निकला था। अधिकांश रेडियोधर्मी आइसोटोप इसके बाद बैक्टीरियोफेज की प्रौद्योगिकी के लिए चले गए।

विभिन्न सूक्ष्म जीवों में रेडियोधर्मी घटक एस  , 32  वर्तमान रेडियोधर्मी घटक नहीं थे बैक्टीरियोफेज और सूक्ष्म जीव के साथ संक्रमण बनाते हैं जो कि बैक्टीरियोफेज पर अलग-अलग खोजे गए थे, हालांकि वे बैक्टीरियोफेज प्रोटीन कोट के भीतर छोड़ दिए गए थे। उपरोक्त प्रयोग से साबित होता है कि बैक्टीरियोफेज डीएनए वह पदार्थ है जो नए बैक्टीरियोफेज का उत्पादन करता है और एक संक्रमण में भाग लेता है। यह पुष्टि की गई है कि डीएनए एक आनुवंशिक सामग्री है, न कि प्रोटीन। इसके अलावा, डीएनए फास्फोरस है, जबकि प्रोटीन में फास्फोरस शामिल नहीं है। डीएनए सल्फर मुक्त है, जबकि प्रोटीन सल्फर है।

क्वेरी 8.
बीच भेद स्पष्ट करें –
(क) पुनरावृत्ति डीएनए और उच्चारण के डीएनए
(ख) mRNA और tRNA
(ग) खाका तार और किनारा कोडिंग
उत्तर
(क)  पुनरावृत्ति डीएनए और उच्चारण के डीएनए के बीच भेद

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड सॉल्यूशंस इनहेरिटेंस Q.8.1 के आणविक आधार

(बी)  mRNA और tRNA के बीच का अंतर

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम Q.8.2 का आणविक आधार

(सी)  टेम्पलेट तार और कोडिंग स्ट्रिंग के बीच का अंतर

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम Q.8.3 के आणविक आधार

क्यू 9.
स्विच के माध्यम से राइबोसोम की दो सबसे महत्वपूर्ण भूमिकाएं रिकॉर्ड करें।
उत्तर
स्थानान्तरण  (अनुवाद) – भुलकेंन के इस कोर्स पर अमीनो एसिड   (पोलीमराइजेशन) के पॉलीपेप्टाइड का निर्माण करते हैं। एमिनो एसिड का अनुक्रम और अनुक्रम दूत आरएनए के भीतर खोजे गए क्षार के अनुक्रम पर निर्भर करेगा   । अमीनो एसिड  पेप्टाइड बांड  (पेप्टाइड बांड) द्वारा संबंधित हैं। पॉलीपेप्टाइड श्रृंखला रिबोसोम से अलग हो जाती है जब स्विच का कोर्स पूरा हो जाता है।

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम Q.9 की आणविक आधार

स्थानान्तरण में राइबोसोम की स्थिति
1. राइबोसोम की छोटी सबयूनिट mR.NA प्रथम कोडन (AUG)  स्मार्मब एडवांस्ड  (दीक्षा जटिल) के साथ बंधी हुई है जो एमिनो एसिल tR.NA द्वारा मान्यता प्राप्त आरंभ टीआरएनए बना रही है। अमीनो एसिड tR.NA को एक पॉश कॉन्फर्मेशन के लिए बांधता है जो बाद में tR.NA की दिशा में एंटिकोडन के साथ एक पूरक क्षार जोड़ी बनाकर mR.NA के उपयुक्त आनुवंशिक कोडन को बांधता है।

2. राइबोसोम के बड़े सबयूनिट पर tRNA अणुओं के सदस्य बनने के लिए दो ब्लॉक होते हैं, इन्हें  P- साइट  या  डोनर वेब साइट  और  A- साइट  या  रिसेप्टर  वेब साइट के रूप में जाना जाता है  । TR.NA पी-साइट (डोनर-साइट) पर पॉलीपेप्टाइड श्रृंखला में शामिल होता है। अमीनो एसाइल tR.NA A- साइट से जुड़ता है। बड़े सबयूनिट   के पेप्टाइड  सिंथेटेज़, एंजाइम पॉलीपेप्टाइड श्रृंखला के एमिनो एसिड के -COOH और एमिनो एसिड tR.NA के एमिनो एसिड के -NOH के बीच पेप्टाइड को बांधता है । 

प्रश्न 10.
एक परंपरा में ई। कोलाई बढ़ रहा है, लैक्टोज को शामिल करके लाख-ऑपेरोन को उत्प्रेरित किया जाता है, फिर लैक्टोज को जब परंपरा में जोड़ा जाता है तो प्रदर्शन करना क्यों बंद हो जाता है?
उत्तर:
ऑपेरॉन आइडिया
ई। कोली, एक जीवाणु जो लोगों के आंत के भीतर खोजा जाता है, आमतौर पर लैक्टोज अपचय से जीवन शक्ति प्राप्त करता है। जैकब  और  मोनोड  (याकूब और मोनोड, 1961) ने पाया कि {डीएनए में तीन जीनों का एक} समूह तीन एंजाइमों के संश्लेषण से जुड़ा है जो लैक्टोज को नीचा करते हैं। ये जीन तब सक्रिय होते हैं जब आहार माध्यम में लैक्टोज होता है। वे आहार माध्यम के भीतर लैक्टोज की अनुपस्थिति के भीतर निष्क्रिय रहना जारी रखते हैं। जैकब  और  मोनोड इस जीन की सक्रियता को नियंत्रित करने के लिए ऑपेरॉन विचार शुरू किया।

 जीन प्रतिलेखन डिग्री प्रेरण  या  दमन के व्यायाम के नियमन के अनुरूप  ऑपेरॉन विचार  (इंडक्शन या दमन) है। एंजाइमों का लैक्टोज ism अपचय के लिए –  गेलकटोसेडेज  ( gal -galactosidase),  गैलेक्टोज प्रमियाज  (गैलेक्टोज परमेस) और  थायोगेलेकटोजाइड ट्रोनोसिटाइलज  (थियोगोग्लाक्टोसिडेज ट्रांसएसेटाइलस) हैं। ये  संरचनात्मक जीन  (संरचनात्मक जीन) क्रमशः  सिस्टरॉन-  z,  सिस्टरॉन- y  और  सिस्ट्रॉन-  द्वारा एक शो। वे एक दूसरे के करीब तैनात हैं। उनके बीच आपसी समन्वय हो सकता है।

तीन जीन उनका प्रबंधन करते हैं, इन्हें  रेगुलेटर जीन  , प्रमोटर जीन और ऑपरेटर जीन कहा जाता है। एक चयापचय प्रणाली में कोड एंजाइमों को अक्सर एक गुणसूत्र पर एक क्लस्टर के रूप में तैनात किया जाता है। ये एक व्यावहारिक जटिल है। इस पूरी प्रणाली को लाख ऑपेरॉन के रूप में जाना जाता है   । इसमें  संरचनात्मक जीन  ,  प्रमोटर जीन  ,  ऑपरेटर जीन  और  नियामक जीन शामिल हैं  ।

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड सॉल्यूशंस इनहेरिटेंस Q.10 के आणविक आधार

लाख ऑपरोन = रेगुलेटर जीन प्रमोटर + जीन + ऑपरेटेट जीन + स्ट्रक्चरल जीन लैक ऑपरेशन लैक्टोज  ( लैक्टोज की अनुपस्थिति में
) के भीतर प्रदर्शन (ए  ) – प्रेरक की अनुपस्थिति में लैक्टोज
बनाता है रेगुलेटिंग जीन एक ब्लैक रेस्ट्रिंग या दमनकारी प्रोटीन होता है। यह ऑपरेटर जीन को बांधता है और इसके प्रतिलेखन को रोकता है। परिणाम में, संरचनात्मक जीन mR.NA


संश्लेषित करने में असमर्थ हैं और प्रोटीन संश्लेषण बंद हो जाता है। यह दमन का एक उदाहरण है।

(बी) लैक्टोज की उपस्थिति के भीतर   ( लैक्टोज की उपस्थिति में) – जब एक लैक्टोज प्रभाव मध्यम के भीतर मौजूद होता है, तो  प्रमोटर  सेल में प्रवेश करता है और नियामक जीन  और प्रकार के जटिल यौगिकों द्वारा उत्पन्न दमनकर्ता को बांधता है  । इसके कारण, दमनकर को ऑपरेटर से नहीं जोड़ा जा सका। और ऑपरेटर निष्पक्ष रहता है। यह आरएनए-पोलीमरेज़ को प्रमोटर जीन के स्थान पर बाँधने के लिए बाध्य करता है जिसके कारण पॉलीसिस्टिक क्रॉनिक लार mR.NA का प्रतिलेखन होता है। यह लैक्टोज अपचय के लिए आवश्यक तीन एंजाइमों को कोड करता है। इस गति को एंजाइम उत्प्रेरक के रूप में जाना जाता है। यह  उत्प्रेरण  या  प्रेरण  (प्रेरण) का एक उदाहरण है। लैक्टोज एक उत्प्रेरक के रूप में कार्य करता है।

(ग)  श्मडनक्र  (सह-दमनकर्ता) – आमतौर पर संयम की रचना के भीतर एक बदलाव या डमनक्र मेटाबोलाइट (लैक्टोज) से बंधा होता है। यह ऑपरेटर को बांधता है और इसके ट्रांसक्रिप्शन को रोकता है। इस पर, मेटाबोलाइट (लैक्टोज) को सहादमनकारा के रूप में जाना जाता है   , इसके परिणामस्वरूप ऑपरेटर वेब साइट को निष्क्रिय करने के लिए प्रतिकारक को संकेत देता है।

प्रश्न 11.
अगले की क्षमताओं का वर्णन करें (एक या दो उपभेदों में) –

  1. उन्नायक (प्रवर्तक)
  2. स्विच आरएनए (टी-आरएनए)
  3. एक्सॉनों

जवाब दे दो

  1. प्रमोटर  – डीएनए का यह अनुक्रम जीन प्रतिलेखन इकाई का गठन करता है और प्रतिलेखन इकाई के भीतर टेम्पलेट और कोडिंग स्ट्रैंड को निर्धारित करता है।
  2. tRNA  – tRNA प्रोटीन संश्लेषण के दौरान साइटोप्लाज्म से राइबोसोम में एमिनो एसिड स्थानांतरित करता है।
  3. एक्सॉन  (एक्सॉन) – इसमें नाइट्रोजनीस बेसों के अनुक्रम शामिल हैं एक्सॉन और यह mRNA के संश्लेषण के भीतर मदद करता है।

प्रश्न 12.
मानव जीनोम अंडरटेकिंग को एक विशाल अंडरटेकिंग क्यों कहा जाता है?
उत्तर:
मानव जीनोम अंडरटेकिंग वास्तव में एक पूर्ण पैमाने पर योजना है जिसके तहत मानव जीनोम के भीतर मौजूद सभी जीनों को मान्यता दी जाती है। ह्यूमन जीनोम थ्री एक्स 10 से  9  बेस बेस और प्राइस तीन यूएस {डॉलर} हर बेस को स्थापित कर सकता है। इस प्रकार सभी योजना $ 9 मिलियन का मूल्य होगा। मान्यता प्राप्त दृश्यों के एक सेट के लिए 1000 पृष्ठों की लगभग 3300 पुस्तकों की आवश्यकता होगी, अगर हर वेब पेज पर 10,000 वाक्यांश लिखे गए हों। योजना को समाप्त होने में 13 साल लगने का अनुमान लगाया गया है।

कई देशों के 1000 वैज्ञानिक इस पर समवर्ती रूप से काम करते हैं, फिर इसके पहले कोर्स को पूरा करने में 10 साल लगते हैं। इस तरह की सूचनाओं के एकत्रीकरण, पूर्णता और मूल्यांकन के लिए उच्च गुणवत्ता वाले सांख्यिकीय उपकरणों की आवश्यकता होगी। इस तथ्य के कारण, इसके विशाल पैमाने के कारण, इस योजना को महा उपक्रम के रूप में जाना जाता है।

प्रश्न 13.
डीएनए फिंगरप्रिंट क्या है? इसकी उपयोगिता पर प्रकाश डाला।
उत्तर
डी ज़ीरो एन ज़ीरो ए ज़ीरो एंगुलिचैपी
डी ज़ीरो एन ज़ीरो ए 0  फिंगर प्रिंटिंग स्ट्रेटजी (अंगुलिचपाई)  प्राथमिक  एलेक जेफ़री  इंग्लैंड में (एलेक जाफ़रीस) द्वारा विकसित किया गया था। इसकी सहायता से, विभिन्न लोगों या जीवों के प्राथमिक आनुवंशिक पदार्थों (डीएनए) के भीतर भिन्नताएं देखी जाएंगी। जैसा कि यह माना जाता है कि जीव की प्रजातियों के प्रत्येक एक सदस्य के पास पूरी तरह से अलग डीएनए कोडेक्स होते हैं। यही कारण है कि  समकक्ष जुड़वांसमतुल्य जुड़वा बच्चों के अलावा, किसी व्यक्ति विशेष के उंगलियों के निशान एक दूसरे से मेल नहीं खाते हैं। समान जीव हर जीव की सभी कोशिकाओं में मौजूद होता है। डीएनए के कारण, एक व्यक्ति विशेष एक व्यक्ति विशेष से पूरी तरह से अलग है। डीएनए के फिंगरप्रिंट डीएनए में तैनात क्षेत्रों को स्थापित करते हैं जो किसी भी व्यक्ति विशेष से भिन्नता की किसी भी मात्रा को इंगित करते हैं।

डीएनए के इन क्षेत्रों के कारण, काया के भीतर विभिन्नताएँ आती हैं। पीसी  डीएनए के लिए सैटेलाइट टीवी इन विविधताओं का प्रदर्शन पीसी  डीएनए के लिए जांच के रूप में उपग्रह टीवी का उपयोग  करता है। इसमें प्रशंसनीय बहुरूपता है। एक्स-रे को उनकी जगह, विशिष्टता, और पता लगाकर फिल्म पर बैंड के अनुक्रम के रूप में प्राप्त किया जाएगा। किसी व्यक्ति के डीएनए का क्रम मूल रूप से स्ट्रिप्स के प्रकार के भीतर विशिष्ट होता है। समतुल्य जुड़वा बच्चों का डीएनए पूरी तरह से समतुल्य होगा।

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड सॉल्यूशंस इनहेरिटेंस Q.13 के आणविक आधार

उन स्ट्रिप्स का डिज़ाइन वैद्युतकणसंचलन  और एक रेडियोधर्मी सामग्री की सहायता से प्राप्त किया  जाता है। विद्युत विषय की उपस्थिति के भीतर, क्षार की मात्रा एक व्युत्क्रमानुपाती विधि में अंतर को निर्धारित करती है जो बैंड या सजीले टुकड़े के प्रकार के भीतर देखी जाती है।

डीएनए फिंगरप्रिंट पूरी तरह से अलग-अलग ऊतकों (रक्त, बालों के रोम, छिद्र और त्वचा, हड्डी, लार, शुक्राणु और आगे से प्राप्त किया जाएगा) से प्राप्त किया जाएगा। डीएनए फिंगरप्रिंट का उपयोग हत्यारे, बलात्कारी को स्थापित करने के लिए अपराध की परिस्थितियों को स्थापित करने के लिए किया जाता है, पितृत्व विवादों में घरेलू संबंधों की खोज करने के लिए, और इसके बाद।

प्रश्न 14.
अगले का संक्षेप में वर्णन करें

  1. ट्रांसक्रिप्शन,
  2. बहुरूपता,
  3. स्विच,
  4. जैव सूचना विज्ञान

उत्तर
1.  ट्रांसक्रिप्शन  – एक कोड के रूप में डीएनए के किस्में के भीतर निहित आनुवंशिक जानकारी में mRNA के ट्रांसक्रिप्शन को प्रतिलेखन के रूप में जाना जाता है। आरएनए पोलीमरेज़ के रूप में संदर्भित एक एंजाइम इस कोर्स के लिए उपयोगी है। डीएनए के न्यूक्लियोटाइड पहले आकार के होते हैं। तब डीएनए अलग हो जाता है और लाइन में एक फफूंदी की तरह काम करता है जिसके साथ आधार एक नए क्रम में व्यवस्थित होते हैं और सामूहिक रूप से एच-बांड द्वारा जुड़ जाते हैं।

2.  बहुरूपता  – अत्यधिक आवृत्ति पर जीन निवासियों में आनुवंशिक उत्परिवर्तन की घटना को बहुरूपता के रूप में जाना जाता है। इस तरह के उत्परिवर्तन डीएनए अनुक्रमों के उत्परिवर्तन के कारण होते हैं और प्रौद्योगिकी से प्रौद्योगिकी और बहुरूपता को ट्रिगर करने के लिए विरासत में मिलते हैं। बहुरूपता के विभिन्न रूप हैं और समान न्यूक्लियोटाइड में या बड़े स्तर पर संशोधन होते हैं।

3.  स्विच  (अनुवाद) – एमआरएनए न्यूक्लियोटाइड का एमिनो एसिड अनुक्रम पॉलीपेप्टाइड श्रृंखलाओं में परिवर्तन को अनुवाद के रूप में जाना जाता है। प्रोटीन संश्लेषण के दौरान राइबोसोम पर यह कोर्स होता है। इस पर, अमीनो एसिड पहले एंजाइम और एटीपी द्वारा सक्रिय होते हैं। सक्रिय अमीनो एसिड को tRNA में स्थानांतरित किया जाता है, वे संश्लेषण शुरू करते हैं। पॉलीपेप्टाइड अनुक्रम तब तय किए जाते हैं। पेप्टाइड बॉन्ड को tRNA अणुओं के बीच मौजूद पेप्टाइड वेब साइट द्वारा आकार दिया जाता है।

4.  जैव सूचना विज्ञान  (बायोइनफॉरमैटिक्स) है – जिसके नीचे जीनोम से संबंधित सांख्यिकी जीवों के जीव विज्ञान वर्गीकरण का विश्लेषण किया जाता है, जिसे जैव सूचना विज्ञान कहा जाता है। इस पर, मानव जीनोम के नक्शे तैयार किए गए हैं और डीएनए अनुक्रम संरेखित किए गए हैं। यह कृषि जादू, जीवन शक्ति निर्माण, पर्यावरण मंत्रमुग्धता, अच्छी तरह से सुरक्षा, और इसके बाद में उपयोग किया जाता है।

सहायक प्रश्न

 चयन
प्रश्नों की एक संख्या 1.
फास्फोडाइस्टरेज़ बाइंडिंग वर्तमान में
(ए) एडीपी है।
(बी) एटीपी
(सी) सी एएमपी
(डी) उनमें से कोई नहीं
उत्तर
(डी)  उनमें से कोई नहीं

2Q
हरगोबिंद ने खुराना को मान्यता दी –
(ए) प्रोटीन संश्लेषण
(बी) आरएनए निर्माण
के आविष्कार के लिए (सी) डीएनए के आविष्कार के लिए निर्माण
(डी) डीएनए के आविष्कार के लिए लाएज एंजाइम
उत्तर
(ए) के लिए  प्रोटीन संश्लेषण

प्रश्न 3.
डीएनए और आरएनए में समानताएं हैं –
(ए) प्रत्येक न्यूक्लियोटाइड में बहुलक श्रृंखलाएं हैं।
(बी) प्रत्येक को संबंधित शर्करा होने की खोज की जाती है।
(C) प्रत्येक में समरूप पिरामिड शामिल हैं।
(डी) प्रत्येक एकल पॉली न्यूक्लियोटाइड श्रृंखला के प्रकार के भीतर हैं।
उत्तर
(ए)  प्रत्येक न्यूक्लियोटाइड की बहुलक श्रृंखला है।

क्वेरी 4.
मैसेंजर आरएनए उत्पादन किया जाता है –
(क) नाभिक में
(ख) राइबोसोम में
में golagicaya (ग)
(घ) जालिका में
उत्तर
(क) में  नाभिक

बहुत जल्दी जवाब सवाल

प्रश्न 1.
आनुवंशिकता के गुणसूत्र सिद्धांत को किसने प्रतिपादित किया?
नॉर्थ
सटन और बोवेरी (सटन एंड बोवेरी, 1902)।

प्रश्न 2.
जीन की परिभाषा दीजिए। जिस स्थान पर उन्हें खोजा गया है?
उत्तर
: मेंडेलियन मुद्दा जो किसी जीव की किसी विशेषता को निर्धारित करता है, जीन के रूप में जाना जाता है। यह आनुवंशिक सामग्री की एक व्यावहारिक इकाई है। गुणसूत्र पर जीन विद्यमान होते हैं।

प्रश्न 3.
अपनी उत्तर पुस्तिका में लिखकर रिक्त स्थान भरें।
डीएनए → ……… → प्रोटीन ”आणविक जीव विज्ञान का केंद्रीय उदाहरण है।
उत्तर:
“डीएनए → आरएनए → प्रोटीन” आणविक जीव विज्ञान का केंद्रीय उदाहरण है।

प्रश्न 4.
न्यूक्लियोसाइड और न्यूक्लियोटाइड के बीच अंतर करना।
जवाब दे दो

  1. न्यूक्लियोटाइड न्यूक्लिक एसिड की एक पूरी इकाई है, जबकि फॉस्फेट रेडिकल (न्यूक्लियोसाइड 4 में पीओ   ) का अभाव है।
  2. न्यूक्लियोसाइड  प्रकृति में प्राथमिक  होते हैं  जबकि न्यूक्लियोटाइड अम्लीय होते  हैं  ।

क्वेरी 5.
सूत्रीकरण के साथ न्यूक्लियोटाइड्स में मौजूद दो शर्करा के नाम लिखें।
जवाब दे दो

  1. रिबोस चीनी – सी  5  एच  10  ओ    और
  2. डीऑक्सीराइबोज शुगर – सी  5  एच  10  ओ  4

प्रश्न 6.
न्यूक्लियोटाइड्स में मौजूद प्यूरीन की पहचान करें।
उत्तर:
एडेनिन और गुआनिन।

प्रश्न 7.
आरएनए और डीएनए का पूरा शीर्षक लिखें।
उत्तर दें:
आरएनए = रिबो न्यूक्लिक एसिड,
डीएनए = डीऑक्सीराइबो न्यूक्लिक एसिड

प्रश्न 8.
प्रोकैरियोटिक और यूकेरियोटिक डीएनए के बीच अंतर।
उत्तर
प्रोटीन आमतौर पर प्रोकैरियोटिक डीएनए से संबंधित नहीं हैं, जबकि हिस्टोन प्रोटीन यूकेरियोटिक डीएनए से संबंधित हैं।

प्रश्न 9.
यूकेरियोटिक कोशिकाओं में डीएनए के कौन से दो रूप मौजूद हैं?
उत्तर
बी – डीएनए और जेड – डीएनए

प्रश्न 10.
Z- डीएनए क्या है? इसके हर कॉइल में कितने न्यूक्लियोटाइड हैं?
उत्तर:
अत्यधिक लवणता के मामले में, बी – डीएनए संशोधन से जेड – डीएनए। इस पर कुंडली वामावर्त है। कुंडल का व्यास 18 is है और प्रत्येक कुंडल में 12 जोड़े न्यूक्लियोटाइड होते हैं।

प्रश्न 11.
डीएनए अणु के द्विभाजित पुतले को किसने प्रतिपादित किया?
उत्तर:
डीएनए अणु का एक द्विभाजित पुतला 1953 में वाटसन, क्रिक, विल्किंस और फ्रैंकलिन (जेडी वाटसन, एफएचसी क्रिक, एमएचएफ विल्किंस और आर। फ्रैंकलिन) नामक वैज्ञानिकों द्वारा प्रस्तावित किया गया था। उनके काम के लिए उन्हें 1962 में नोबेल पुरस्कार दिया गया था।

प्रश्न 12.
पारगमन क्या है?
उत्तर:
अभिकर्मक वह विधि है जिसके द्वारा डीएनए को एक जीवाणु (वायरस) द्वारा एक जीवाणु से दूसरे स्थान पर स्थानांतरित किया जाता है।

त्वरित उत्तर वाले प्रश्न

प्रश्न 1.
चीनी का डीऑक्सीराइबोज क्या है? इस चीनी के आणविक निर्माण को आकर्षित करें।
उत्तर:
डीऑक्सीराइबोज शर्करा डीएनए में मौजूद होता है। यह 5 कार्बन अमीर (5C) है। इसका पाँचवाँ कार्बन परमाणु वलय है। एक चीनी का प्राथमिक कार्बन परमाणु एक ग्लाइकोसिडिक बंधन द्वारा नाइट्रोजन आधार से जुड़ा हुआ है, जबकि तीसरा और पांचवां कार्बन परमाणु हर समय फॉस्फेट अणु से बंधता है। 2 चीनी अणु एक दूसरे के साथ तीसरे कार्बन (3C) और पांचवें कार्बन (5C) एक फॉस्फेट अणु फॉस्फोडाइस्टर बांड द्वारा जुड़े हुए हैं।

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम 2Q.1 का आणविक आधार

प्रश्न 2.
डीएनए अणु के निर्माण के भीतर चारगफ के कानूनी दिशानिर्देशों के महत्व को स्पष्ट करें।
उत्तर:
शार्गफ  ने विभिन्न जीवों के डीएनए का अध्ययन किया और स्वीकार किया कि

  1. सभी डीएनए अणुओं में प्यूरिन बेस की मात्रा पिरिमिडीन बेस के समान है। इस तथ्य के कारण
  2. हालांकि
    , विभिन्न प्रजातियों के जीवों के डीएनए के भीतर एडेनिन + थाइमिन और गुआनिन + साइटोसिन के अनुपात (ए + टी: जी + सी) समान प्रजातियों के जीवों में संबंधित हैं।
  3. समान जीव के सदस्यों में मौजूद डीएनए के पूरे अणु में विभिन्न प्रकार के आधार होते हैं।

उपरोक्त अवधारणाओं को अक्सर “शार्गफ के नियम” के रूप में जाना जाता है।
वाटसन और क्रिक ने अतिरिक्त रूप से डीएनए के पुतले को चालू करने के लिए चार्गफ के दिशानिर्देशों की सहायता ली।

प्रश्न 3.
डीएनए और आरएनए के बीच का अंतर लिखें।
उत्तर:
डीएनए और आरएनए के बीच का अंतर

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम 2Q.3 का आणविक आधार

प्रश्न 4.
आरएनए के क्या रूप हैं? उनके काम को स्पष्ट करें।
या
राइबोसोमल आरएनए पर एक स्पर्श लिखें।
या
कई प्रकार के आरएनए अणुओं का वर्णन करते हैं जो प्रोटीन संश्लेषण में भाग लेते हैं।
या
कई प्रकार के आरएनए का शीर्षक लिखें।
उत्तर  आरएनए के आरएनए
प्रकार में
आणविक भार के साथ पोलिन्यूक्लियोटाइड्स होते हैं। यह डीएनए से भिन्न होता है, क्योंकि इसमें डी-ऑक्सीराइबोज़ शर्करा के बजाय राइबोस शर्करा शामिल होता है और नाइट्रोजन आधार थाइमिन के बजाय यूरैसिल होता है। हर कोशिका में आरएनए के तीन रूप हैं –

1.  मैसेंजर आरएनए  (एमआरएनए) – वे नाभिक के भीतर डीएनए वर्तमान पर प्रतिलेखन की गति से आकार लेते हैं। वे सेल के पूरे आरएनए के 3 – 5% को शामिल करते हैं और 500,000 से 2,000,000 तक आणविक भार होते हैं। वे नाभिक के भीतर डीएनए के नए साँचे पर आकार लेते हैं। 1961 में, फ्रांसिस जैकब और जैक्स मोनोड ने उन्हें दूत आरएनए अणुओं का नाम दिया।
विशेषताएं  : दूत आरएनए अणु साइटोप्लाज्म बाहरी नाभिक में प्रवेश करता है। यहाँ यह नाभिक से आदेश लेकर राइबोसोम पर कई प्रकार के प्रोटीन बनाता है।

2.  राइबोसोमल  आरएनए – ये आरएनए के संरचनात्मक अणु हैं। यह सेल के पूरे आरएनए का 80% हिस्सा है। आरएनए नाभिक के भीतर डीएनए से उत्पन्न होता है। यह आरएनए के तीन रूपों में से सबसे जीवंत है। प्रत्येक राइबोसोम में लगभग 65% में आरआरएनए होता है और शेष 35% प्रोटीन होता है।
सुविधाएँ  – rRNAs राइबोसोम के निर्माण के भीतर भाग लेते हैं। यह प्रोटीन संश्लेषण में मदद करता है।

3.  ट्रांसफर आरएनए  (tRNA या sRNA) – यह सेल के पूरे आरएनए का 15-18% बनता है। यह साइटोप्लाज्म में मौजूद है। ये सबसे छोटे और घुलनशील अणु हैं; इसलिए, वे अतिरिक्त रूप से घुलनशील आरएनए अणुओं के रूप में संदर्भित होते हैं। वे नाभिक के भीतर डीएनए टेम्पलेट पर निर्मित होते हैं।
विशेषताएं  – वे कई प्रकार के अमीनो एसिड को राइबोसोम में लाते हैं, जिस स्थान पर प्रोटीन संश्लेषण होता है।

प्रश्न 5.
आनुवंशिक कोड या आनुवंशिक कोड क्या हैं? आनुवांशिक कोड के भीतर एक अंतर और एक समाप्ति कोडन की खोज करें।
या
एक आनुवंशिक कोड क्या है? इसके 4 लक्षण लिखिए।
या
कोडन खोलकर और कोडन को बंद करके आप क्या अनुभव करते हैं?
उत्तर:
आनुवंशिक कोड या आनुवंशिक कोड
डीएनए आनुवांशिक जानकारी या संदेशों के एक टेप की तरह है जिसमें नाइट्रोजन के आधार के सीरियल किस्म के प्रकार के आनुवंशिक संदेश शामिल हैं। प्रोटीन में आमतौर पर 20 प्रकार के अमीनो एसिड शामिल होते हैं, हालांकि न्यूक्लिक एसिड में केवल 4 आधार शामिल होते हैं। यह भी उल्लेख किया जा सकता है कि प्रोटीन भाषा की वर्णमाला के भीतर 20 अमीनो एसिड अल्फाबेट हैं। समान रूप से, न्यूक्लिक एसिड की भाषा वर्णमाला में 4 क्षार अक्षर होते हैं क्योंकि आनुवंशिक जानकारी एम-आरएनए के माध्यम से प्रोटीन तक पहुंचती है, इसलिए प्रोटीन की भाषा में आरएनए की भाषा का अनुवाद करने के लिए एक शब्दकोश तैयार करना एक आनुवंशिक कोड है। कोड) मुद्दा था।

चार अक्षर की भाषा और 20 अन्य अक्षर वाली भाषा होने के नाते, यह आरएनए भाषा का एक अक्षर अर्थात एक क्षार प्रोटीन भाषा के 1 अक्षर या एक एमिनो एसिड के बराबर नहीं है। इस प्रकार  आनुवंशिक कोड प्रणाली के भीतर 4 3 = चार x चार x 4 = 64 कोडों का एक पूरा होता  है।

इस संबंध में कई सिद्धांतों की पेशकश की गई थी, हालांकि क्रिक (EH.C. क्रिक) द्वारा पेश की गई अवधारणा अनिवार्य रूप से सबसे वैध है। इस सिद्धांत के अनुरूप, प्रत्येक अमीनो एसिड के लिए तीन नाइट्रोजन आधारों का अनुक्रम या ट्रिपल कोड है; इस तथ्य के कारण, आनुवंशिक कोड या आनुवंशिक कोड डीएनए अणुओं में नाइट्रोजन आधारों का एक क्रम है जिसमें प्रोटीन अणुओं के संश्लेषण के लिए संदेश शामिल हैं।

कोडन  – न्यूक्लियोटाइड्स का एक गुच्छा जिसमें एक एकल अमीनो एसिड के लिए एक संदेश या कोड शामिल होता है, कोडन के रूप में जाना जाता है; के समान – AUG शुरुआत कोडन है।
एंटिकोडोन  हैं ( एंटिकोडन ) – तीन कास्टिक समूह के लिए टी-आरएनए में वर्तमान एम-आरएनए में वर्तमान कोडन को बढ़ाता है, एंटिकोडन (एंटिकोडन) कहते हैं।

ट्रिपल कोड  (ट्रिपल कोड) – गैमो (गेमो, 1954) ने तीन-अक्षर कोड के अवसर का खुलासा किया। डीएनए और आरएनए में 4 न्यूक्लियोटाइड की एक पूरी होती है और लगभग 20 अमीनो एसिड का कॉन्फ़िगरेशन कोड उनके कॉन्फ़िगरेशन पर अनुमानित होता है। यह मानते हुए कि प्रत्येक कोड सिर्फ एक न्यूक्लियोटाइड से बना है, तो यह 4 कोडों का एक पूर्ण निर्माण कर सकता है जो केवल चार एमिनो एसिड के विन्यास का प्रबंधन कर सकते हैं। यदि हर कोड दो न्यूक्लियोटाइड से बना है, तो (16 x 4) पूरी तरह से 16 कोड आकार का होगा। ये भी आमतौर पर 20 एमिनो एसिड के लिए पर्याप्त नहीं हैं। तीन न्यूक्लियोटाइड्स से बना एक कोड (चार x चार x 4 = 64) 64 कोड वाक्यांश बनाता है। ये बीस एमिनो एसिड के लिए आवश्यकता से अधिक हैं; इसलिए गैमो के तीन अल्फ़ाबेटिक कोड की संभावना सही है।

सीक्वेंस स्मार्मब और
सिस्टरन स्मार्मब कोडन के प्राथमिक कोडन के लिए  एक कोडन के साथ बंद करना  (दीक्षा कोडन) कहते हैं। यह संदेश देता है कि पॉलीपेप्टाइड श्रृंखला कोडित है। अधिकांश श्रृंखलाओं में AUG प्रारंभ कोडन शामिल हैं। यह एक अमीनो एसिड को मेथियोनीन के रूप में संदर्भित करता है। समान रूप से, सिस्ट्रोन का अंतिम कोडन पॉलीपेप्टाइड श्रृंखला को समाप्त करता है। यह  निष्कर्ष निकाला कोडन  कहता है (समाप्ति कोडन)। समापन कोडन तीन हैं – यूएए, यूजीए और यूएजी। प्रारंभ में, एक बार जब उनके पास अपने काम का कोई डेटा नहीं था, तो उन्हें बकवास कोडन के रूप में संदर्भित किया गया था।

विस्तृत उत्तर प्रश्न

प्रश्न 1.
डीएनए के आणविक निर्माण का वर्णन करें और डीएनए के दोहराव के भीतर इसके महत्व को स्पष्ट करें।
या
उपयुक्त आरेख बनाकर डीएनए के निर्माण के वाटसन और क्रिक पुतले को स्पष्ट करें।
या
न्यूक्लिक एसिड की परिभाषा लिखें। वाटसन और क्रिक द्वारा प्रस्तावित डीएनए पुतला के निर्माण का वर्णन करें।
या
वाटसन और क्रिक द्वारा निर्मित डीएनए की रासायनिक संरचना का वर्णन करें और एक आनुवंशिक सामग्री के रूप में इसकी मान्यता को इंगित करें।
उत्तर:  पहले न्यूक्लियस (1889) ने
न्यूक्लिक एसिड को
हटा दिया, उसमें से प्रोटीन को अलग किया और शेष फॉस्फोरस के परिणामस्वरूप न्यूक्लिक एसिड के रूप में संदर्भित किया। डीएनए और आरएनए के दो रूप हैं।

डीऑक्सीराइबो न्यूक्लिक एसिड (डीएनए) और इसका निर्माण
एक  डीएनए  (डीऑक्सीराइबो न्यूक्लिक एसिड) अणु एक बहुलक है जो आनुवांशिक लक्षणों को एक तकनीक से एक दूसरे तक पहुंचाता है; इसलिए, इसके अतिरिक्त इसे आनुवंशिकता के अणु के रूप में जाना जाता है। डीएनए (डीऑक्सीराइबो न्यूक्लिक एसिड) फ्रेडरिक मेइकर (फ्रेडरिक मिसेचर, 1869) द्वारा पाया गया था। विल्किंस और फ्रैंकलिन (1952) ने पहली बार बताया कि डीएनए एक पेचदार निर्माण है। 1953 में, वाटसन और क्रिक ने डीएनए निर्माण के डबल हेलिक्स पुतले की पेशकश की।

इसे दो लंबी जंजीरों से बनाएं। ऐसे हेलिकॉप्टर हैं जिन्हें मुख्य रूप से न्यूक्लियोटाइड के रूप में संदर्भित विशेष मॉडल से बनाया जा सकता है। इस प्रकार, एक अणु में 1000 के 1000 न्यूक्लियोटाइड होते हैं, यानी ये चेन पॉली न्यूक्लियोटाइड चेन हैं। इस प्रकार, डीएनए का निर्माण कई पॉलिमर की श्रृंखलाओं के दोहराव द्वारा आकार दिया गया है। ये श्रृंखलाएं बहुत लंबी हैं और अणु बहुत विशाल हैं। हर श्रृंखला का हर न्यूक्लियोटाइड एक निश्चित और परिष्कृत निर्माण है। इसमें स्वयं अणु या मूलक के तीन रूप होते हैं, जिसके द्वारा

1.  एक पेन्टोज़ शुगर, डीऑक्सीराइबोज़ सॉर्ट यानी यह एक पाँच-कार्बन चीनी है।
2.  एक फॉस्फेट बेस जो 1 अणु फॉस्फोरिक एसिड = एच  3  पीओ  4 से बना होता है  ।
3.  एक नाइट्रोजन आधार जो दो किस्मों का है और कई पूर्ण 4 आधारों में से एक है। ये हैं –
(ए)  प्यूरीन  सॉर्ट जिसमें 2-एन रिंग है; ये हैं – एडेनिन और गुआनिन और

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम 3Q.1.1 का आणविक आधार
कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम 3Q.1.2 के आणविक आधार

(बी)  पिरिमिडिन  (पिरिमिडीन) सॉर्ट एक एकल अंगूठी नाइट्रोजन है; उदाहरण साइटोसिन और थाइमिन आधार हैं।

डीएनए के एकल अणु में, डीऑक्सीराइबोज़ चीनी का एक अणु आधार के 1 अणु से जुड़ा होता है। इस यौगिक को डीऑक्सीराइबोसाइड के रूप में जाना जाता है। यह एक न्यूक्लियोसाइड है। अब यह न्यूक्लियोसाइड फॉस्फोरिक एसिड (HI PO4) के साथ मिलकर डीऑक्सीराइबो न्यूक्लियोटाइड बनाता है। न्यूक्लियोटाइड के एक अणु में, हर समय नीचे का अणु चीनी के अणु को बांधता है। समान रूप से, फॉस्फोरिक एसिड का एक अणु भी चीनी के एक अणु से जुड़ा हो सकता है।

डीएनए अणु में न्यूक्लियोसाइड के 4 रूप होते हैं और 4 न्यूक्लियोटाइड्स होते हैं जो 4 पूरी तरह से अलग नाइट्रोजन आधार होते हैं। एक डीएनए अणु में दो लंबी श्रृंखलाएं होती हैं जिनके द्वारा नीचे का अणु अक्ष पर होता है। 2 श्रृंखलाओं के आधारों के अणु हाइड्रोजन बॉन्ड (एच-बॉन्ड) द्वारा एक दूसरे के साथ मिश्रित होते हैं ताकि आधारों की एक जोड़ी बनाई जा सके। इन हाइड्रोजन बांडों के बीच दो.83 – 2.90 A का स्थान है। ये बंधन न्यूक्लियोटाइड की दो श्रृंखलाओं को बांधते हैं।

ये दो श्रृंखलाएं एक दूसरे के पूरक हैं। ये दोनों श्रृंखलाएं एक दूसरे के लिए एक दूसरे के समानांतर हैं अर्थात एकल श्रृंखला में फॉस्फोडिएस्टर लिंकेज एक मार्ग में 3 ‘→ 5 ip और एक अलग श्रृंखला में 5’ → 3 ip गलत तरीके से होता है। इस साधन पर, डीएनए एक सीढ़ी की तरह दिखता है। डीएनए का व्यास 20 20 है।

DAA
1953 में, वाटसन, क्रिक, विल्किंस, और फ्रैंकलिन (JD वाटसन, EH.C. क्रिक, MHE विल्किंस और आर। फ्रैंकलिन) नाम के वैज्ञानिकों ने डीएनए का एक द्विभाजन पुतला (एक्स-रे विवर्तन अनुसंधान) किया था। डबल पेचिकल पुतला) जिस पर उन्होंने 1962 में नोबेल पुरस्कार प्राप्त किया था। इस पुतले के अनुरूप, डीएनए अणु पोलिने न्यूक्लियोटाइट्स के दो स्ट्रैंड से बना है। 2 एक समान केंद्रीय अक्ष पर स्थिर होता है और धुरी के पार एक डबल पेचदार निर्माण होता है। हर दौर के निर्माण में 10 जोड़े न्यूक्लियोटाइड होते हैं और एक चक्र से भिन्न तक का अंतर 34 होता है, अर्थात एक दूसरे न्यूक्लियोटाइड से 1 न्यूक्लियोटाइड का अंतर 3.Four pairs है। Φ × 174 कोलीफ़ेज और 513 ई। कोलाई भाग (ई। कोटि भाग के रूप में संदर्भित वायरस के अपवाद में डीएनए में पॉली डीऑक्सीराइबोन्यूक्लियोटाइड के एक ही स्ट्रैंड होते हैं।

प्रत्येक क्षार जोड़ी में, प्यूमिनिड के थाइमिन के पाइरीमिडीन प्रकार के साथ फुटपाथ के सभी प्रकार के एडेनिन के प्यूरिन प्रकार और प्यूरीन बेस के गनीनी प्रकार में हर समय साइटोसिन बेस के पाइरीमिडीन प्रकार के साथ संयोजन होता है। । इस पर हर दूसरे प्रकार की कोई जोड़ी संभव नहीं है। इस प्रकार, यदि टीसीजीएटीसीजी और इसके आगे हैं। एक क्रम में तो दूसरे क्रम में T और G के प्रवेश में पूरी तरह से A होगा, C के प्रवेश द्वार में C, G के प्रवेश द्वार में A और उसके बाद का प्रवेश द्वार होगा। ऐशे ही

कक्षा 12 जीव विज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम 3Q.1.3 के आणविक आधार

मार्ग के भीतर न्यूक्लियोटाइड्स के आधार हाइड्रोजन बांड (एच-बॉन्ड) द्वारा जुड़े हुए हैं। इसमें एडीनिन, थाइमिन के साथ दो साइटोसिन, ग्वानिन के साथ तीन निश्चित होते हैं। ठिकानों का विशेष अनुक्रम डीएनए की रासायनिक शब्दावली को टाइप करता है, जो आनुवंशिक लक्षणों को स्थापित करता है।
[संकेत –  विस्तृत उत्तर प्रश्न 2 के उत्तर में डीएनए की संरचना का महत्व देखें ।]

प्रश्न 2.
डीएनए प्रतिकृति के सबसे महत्वपूर्ण चरणों को इंगित करें। डीएनए की महत्वपूर्ण क्षमताएं क्या हैं?
या
डीएनए के दोहराव का एक त्वरित विवरण दें ।
या
डीएनए के अर्धवृत्त द्वैध पद्धति का वर्णन करें।
उत्तर
डी ज़ीरो एन ज़ीरो ए ज़ीरो ऑफ़ डुप्लीकेशन
वाटसन और क्रिक ने पहचान की कि डीएनए एक द्विविभाजक निर्माण है जिसमें दो पॉली न्यूक्लियोटाइड श्रृंखलाएं होती हैं। ये जंजीरें एक दूसरे के समानांतर और पूरक हैं। डीएनए अणु का द्विध्रुवीकरण अर्धवृत्ताकार है। जिसका अर्थ है कि नए आकार के डीएनए अणु के भीतर, एक किनारा माता-पिता का होगा और विपरीत सूत्रीकरण नए आकार का होगा। 1958 में मैथ्यू मेसल्सन। (मैथ्यू मेसल्सन) और फ्रेंकलिन स्टाहल ने इस तरह के द्विगुणित होने की पुष्टि एक जीवाणु के डीएनए अणु पर की है जिसे आइशरचिया कोली = ई। कोली कहा जाता है। हम डीएनए के दोहराव को अगले मुख्य चरणों में विभाजित करेंगे –

1.  D Zero N Zero A Zero Akundln और Prakundlonl अणुओं का पुन्क्रंड्लन  हैं (डीएनए मोलेक्यूलर के Supercoils का डेकोलिंग और रिकॉइलिंग) – D Zero N Zero A0 Prakundln और Akundln अणुओं को नियंत्रित करता है जो सुनिश्चित एंजाइम, टोपोइसेमरेज (टोपोइसोमेरेस) बनाते हैं। एंजाइमों के लिए, ये एंजाइम नियमित रूप से डीएनए अणु के छोटे मूल क्षेत्रों में इसके विरूपण को समाप्त करके द्वैध को खोलते हैं और इसी तरह द्विगुणित होने के बाद माता या पिता के अणुओं को पुन: व्यवस्थित करते हैं। टोपोइज़ोमेरेज़ -1 (टोपोइज़ोमेरेज़ेज़- I) और टोपोइज़ोमेरेस- II (टोपोओज़ोमेरेस- II) के दो रूप हैं।

टोपोइज़ोमेरेज़- I डीएनए के कई किस्में में से एक में ट्रंकेशन का उत्पादन करता है, जबकि टोपोइज़ोमेरेज़- II डीएनए के प्रत्येक स्ट्रैंड में ट्रंकेशन उत्पन्न करता है। यह आमतौर पर डीएनए गाइरस के रूप में जाना जाता है। पूरी तरह से उन कटावों के गठन के बाद, देशी सर्पिल से शेष बाइसेप्सिड के भीतर रोटेशन समाप्त होता है। ऐसा होता है।

2.  Dvikundlini उद्घाटन  कर रहे हैं (डबल हेलिक्स की Unwinding) – डी शून्य एन शून्य A0 अणु दोहराव निश्चित स्थानों पर होता है दोहराव मूल (प्रतिकृति मूल) कहते हैं। यूकेरियोटिक कोशिकाओं में डीएनए तुलनात्मक रूप से लंबा, रैखिक है, वे एक से कई जोड़े में भिन्न होते हैं। यह हर अणु के द्विगुणित के लिए द्विगुणित जड़ों की संख्या है। इन द्विगुणित जड़ों पर, उत्पत्ति-बंधनकारी प्रोटीन के निश्चित रूप बिपिराइडिलिनी से जुड़े होते हैं। यह यहीं है कि कई प्रकार के प्रोटीन और एंजाइम द्विगुणित में पूरी तरह से अलग भूमिका निभाते हैं।

ई। कोलाई में, इन प्राथमिक प्रोटीन को ‘ओरी सी’ नाम दिया गया है। ये प्रोटीन, एटीपी की सहायता से, द्विगुणित जड़ों की दरार के जोड़े से एच-बांड को हटा देते हैं। डबल हेलिक्स खुलता है क्योंकि द्विगुणित अद्वितीय एच-बांड को तोड़ता है, जिसे डीएनए अणु के पिघलने के रूप में संदर्भित किया जाता है। 2 कॉइल्स के पृथक्करण से एक बाइसेप्स बनता है, प्रतिकृति कांटा-जैसा निर्माण होता है, जैसे ‘वाई’ चिमटी से बनता है। डीएनए हेलिकेज़ के रूप में संदर्भित एंजाइम का एक बड़ा अणु एक सूत्रीकरण द्वारा प्रत्येक द्विभाजन पर लिपटा होता है। यह एंजाइम डीएनए के स्रोतों के क्रमिक उद्घाटन के रूप में कार्य करता है।

3.  न्यूक्लियोटाइड्स का  सक्रियण ( न्यूक्लिओटाइड्स का सक्रियण) – न्यूक्लियोसाइड एंजाइम फॉस्फोरेलिज (फॉस्फोराइलेज) और ई जीरो टी जीरो पी 0. की उपस्थिति के भीतर सक्रिय होते हैं। इस कोर्स को फॉस्फोराइलेशन के रूप में जाना जाता है।

4.  R Zero n Zero A0 निर्माण  उशेर (RNA प्राइमरों का गठन) – दोहराव की शाखाएँ होती हैं, जो Raibonucliotaid (राइबोन्यूक्लियोटाइड) एक छोटे से पूरक (अनुपूरक) अनुक्रम (RNA अणु) के छोटे अणुओं को तोड़ती है, जो हर डीएनए की आपूर्ति पर होते हैं। हर दविश। इन आरएनए अणुओं को प्राइमरों के रूप में संदर्भित किया जाता है, क्योंकि डीएनए की एक नई श्रृंखला को उन के 3 of छोरों पर डीऑक्सीराइबो न्यूक्लियोटाइड अणुओं को शामिल करके संश्लेषित किया जाता है। आरएनए प्राइमर का संश्लेषण एक प्राइमेज एंजाइम या आरएनए पोलीमरेज़ की सहायता से पूरा होता है।

5. गठन और  बढ़ाव  डीएनए की  श्रृंखला  – संरचना और  बढ़ाव  डीएनए की  श्रृंखला  – एंजाइम डीएनए पोलीमरेज़-III (डीएनए पोलीमरेज़-तृतीय) 5 ‘→ 3’ शाही सेना प्राइमर के भीतर पथ के भीतर नए ठिकानों प्रदान करता है। उन ठिकानों का अनुक्रम डीएनए टेम्पलेट के अनुरूप है। डीएनए अणु के दो निरूपण प्रतिवर्ती होते हैं अर्थात किसी का मार्ग 5 ′ → 3 DNA होता है और इसके विपरीत 3 has → 5 DNA होता है।

एंजाइम डीएनए पोलीमरेज़ III केवल 5 ′ – 3 DNA पथ के भीतर आधार जोड़ सकता है; इसलिए, नवीनतम डीएनए अनुक्रम का स्थिर संश्लेषण पथ 3 5 – 5 3 के साथ डीएनए टेम्पलेट पर होता है। इस तरह के सूत्रीकरण को अगुआ सूत्र या मुख्य स्ट्रैंड के रूप में जाना जाता है। इसके विपरीत, ब्रांड नई डीएनए श्रृंखला को 3 ‘→ 5 it’s पथ के भीतर आकार दिया गया है अर्थात यह 5’ → 3। पथ के भीतर पैतृक निर्माण पर असतत है। इस साधन पर, यह इमारत छोटे ब्लॉकों के प्रकार के भीतर होती है, इन ब्लॉकों को ओकाजाकी टुकड़े के रूप में जाना जाता है। इस प्रकार, ब्लॉकों के प्रकार के निर्माण के परिणामस्वरूप, इस नए सूत्र को पिछड़ी रस्सी या लैगिंग स्ट्रैंड के रूप में जाना जाता है। अलग टुकड़ों में पिचुरा सूत्र के गठन की विधि रोजी ओकाजाकी (रीजी ओकाजाकी 1968) द्वारा पाई गई थी।

कक्षा 12 जीवविज्ञान अध्याय 6 के लिए यूपी बोर्ड समाधान वंशानुक्रम 3Q.2 का आणविक आधार

6.  R Zero n Zero A Zero recoil of Usher  (RNA प्राइमर को हटाना) – डीएनए श्रृंखला के आकार बदलने के बाद R Zero n Zero A Zero Usher (आरएनए प्राइमर) अलग-अलग होता है। डीएनए पोलीमरेज़- I आरएनए मर्मज्ञ के उन्मूलन द्वारा उत्पन्न रिक्त स्थान को भरने में मदद करता है। जब डीएनए का निर्माण पूर्ण होता है, तो एंजाइम डीएनए हेलिकेज़ की गति रुक ​​जाती है।


माना जाता है कि डीएनए का महत्व और प्रदर्शन न्यूक्लिक एसिड को बनाए रखने का मुख्य आधार है। तकनीक से प्रौद्योगिकी तक, वे इन संकेतों के नीचे अपने असाइन किए गए कार्यों को सही तरीके से, सही तरीके से और सामान्य और प्रबंधित प्रतिक्रियाओं द्वारा निष्पादित करते हैं। ऐशे ही –

  1. डीऑक्सीराइबो न्यूक्लिक एसिड (डीएनए) आनुवंशिक जानकारी के प्रदाता के रूप में कार्य करता है। और पुरानी तकनीक से ब्रांड की नई तकनीक तक सभी आनुवांशिक लक्षणों को वहन करता है।
  2. डीएनए द्वारा उत्पादित रिबोन्यूक्लिक एसिड (आरएनए) विभिन्न अमीनो एसिड से डीएनए-निर्देशित प्रोटीन को संश्लेषित करते हैं, जो कि क्रिया-प्रतिक्रियाओं की एक विस्तृत श्रृंखला के लिए अनुमति देने के लिए एंजाइम के रूप में उपयोगी होते हैं।
  3. डीएनए के एक हिस्से पर या उसके द्वारा उत्पादित कुछ न्यूक्लियोटाइड हार्मोन, सह-एंजाइम और इसके आगे के रूप में कार्य करते हैं।
  4. समझ की योजना नीचे दी गई है कि कौन से कोशिकाएं आकार में हैं और एक जीव में प्रसव से लेकर निधन तक का प्रदर्शन होता है, इसका प्राथमिक ब्लू प्रिंट डीएनए के प्रकार के भीतर है।

हमें उम्मीद है कि कक्षा 12 जीव विज्ञान अध्याय 6 “वंशानुक्रम फाउंडेशन के लिए यूपी बोर्ड मास्टर” (“आणविक फाउंडेशन ऑफ इनहेरिटेंस”) मदद प्रदान करते हैं। यदि आपके पास कक्षा 12 जीव विज्ञान अध्याय 6 “वंशानुक्रम फाउंडेशन के” (“आणविक फाउंडेशन ऑफ इनहेरिटेंस”) के लिए यूपी बोर्ड मास्टर से संबंधित कोई प्रश्न है, तो नीचे एक टिप्पणी छोड़ दें और हम आपको जल्द से जल्द फिर से मिलेंगे।

UP board Master for class 12 English chapter list Source link

Leave a Comment

Your email address will not be published.

Share via
Copy link
Powered by Social Snap